NCERT Solutions for Class 12 Science Biology Chapter 6 – Molecular Basis Of Inheritance
Here are simplified, step-by-step explanations for the NCERT Solutions for Class 12 Science Biology Chapter 6, “Molecular Basis Of Inheritance”. These solutions are widely favored by Class 12 Science students for Biology as they aid in swiftly completing homework and preparing for exams. All questions and answers from the NCERT Book of Class 12 Science Biology Chapter 6 are available here at no cost, providing invaluable assistance to students. Page No 125: Question 1: Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. ANSWER: Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine. Nucleosides present in the list are cytidine and guanosine. Page No 125: Question 2: If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA. ANSWER: According to Chargaffโs rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules. % A = % T and % G = % C If dsDNA has 20% of cytosine, then according to the law, it would have 20% of guanine. Thus, percentage of G + C content = 40% The remaining 60% represents both A + T molecule. Since adenine and guanine are always present in equal numbers, the percentage of adenine molecule is 30%. Page No 125: Question 3: If the sequence of one strand of DNA is written as follows: 5‘-ATGCATGCATGCATGCATGCATGCATGC-3‘ Write down the sequence of complementary strand in 5‘โ3‘ direction ANSWER: The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is 5‘– ATGCATGCATGCATGCATGCATGCATGC โ 3โ Then, the sequence of complementary strand in direction will be 3‘– TACGTACGTACGTACGTACGTACGTACG โ 5โ Therefore, the sequence of nucleotides on DNA polypeptide in direction is 5‘– GCATGCATGCATGCATGCATGCATGCATโ 3โ Page No 125: Question 4: If the sequence of the coding strand in a transcription unit is written as follows: 5‘-ATGCATGCATGCATGCATGCATGCATGC-3‘ Write down the sequence of mRNA. ANSWER: If the coding strand in a transcription unit is 5โโ ATGCATGCATGCATGCATGCATGCATGC-3โ Then, the template strand in 3โ to 5โ direction would be 3โ โ TACGTACGTACGTACGTACGTACGTACG-5โ It is known that the sequence of mRNA is same as the coding strand of DNA. However, in RNA, thymine is replaced by uracil. Hence, the sequence of mRNA will be 5โ โ AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3โ Page No 125: Question 5: Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain. ANSWER: Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semi-conservative. It means that the double stranded DNA molecule separates and then, each of the separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA molecule would have one parental strand and a newly synthesized daughter strand. Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of replication. Page No 125: Question 6: Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases. ANSWER: There are two different types of nucleic acid polymerases. (1) DNA-dependent DNA polymerases (2) DNA-dependent RNA polymerases The DNA-dependent DNA polymerases use a DNA template for synthesizing a new strand of DNA, whereas DNA-dependent RNA polymerases use a DNA template strand for synthesizing RNA. Page No 125: Question 7: How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material? ANSWER: Hershey and Chase worked with bacteriophage and E.coli to prove that DNA is the genetic material. They used different radioactive isotopes to label DNA and protein coat of the bacteriophage. They grew some bacteriophages on a medium containing radioactive phosphorus (32P) to identify DNA and some on a medium containing radioactive sulphur (35S) to identify protein. Then, these radioactive labelled phages were allowed to infect E.coli bacteria. After infecting, the protein coat of the bacteriophage was separated from the bacterial cell by blending and then subjected to the process of centrifugation. Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria. Page No 125: Question 8: Differentiate between the followings: (a) Repetitive DNA and Satellite DNA (b) mRNA and tRNA (c) Template strand and Coding strand ANSWER: (a) Repetitive DNA and satellite DNA Repetitive DNA Satellite DNA 1. Repetitive DNA are DNA sequences that contain small segments, which are repeated many times. Satellite DNA are DNA sequences that contain highly repetitive DNA. (b) mRNA and tRNA mRNA tRNA 1. mRNA or messenger RNA acts as a template for the process of transcription. tRNA or transfer RNA acts as an adaptor molecule that carries a specific amino acid to mRNA for the synthesis of polypeptide. 2. It is a linear molecule. It has clover leaf shape. (c) Template strand and coding strand Template strand Coding strand 1. Template strand of DNA acts as a template for the synthesis of mRNA during transcription. Coding strand is a sequence of DNA that has the same base sequence as that of mRNA (except thymine that is replaced by uracil in DNA). 2. It runs from 3โ to 5โ. It runs from 5โto 3โ. Page No 125: Question 9: List two essential roles of ribosome during translation. ANSWER: The important functions of ribosome during translation are as follows. (a) Ribosome acts as the site where protein synthesis takes place from individual amino acids. It is made up of two subunits. The smaller subunit comes in contact …
NCERT Solutions for Class 12 Science Biology Chapter 6 – Molecular Basis Of Inheritance Read More »